17 results for search term 'crispr'  in category Model System

kidney organoid

Model System  - [In Vitro] [Human]
Matched Fields: category : Model System deliverySystemName : CRISPRMAX grnaLabId : Alt-R CRISPR-Cas9 Negative Control crRNA #1 guide : Alt-R™ CRISPR-Cas9 Negative Control crRNA #1
kidney organoid derived from human iPS cells

BALB/c mouse

Model System  - [In Vivo] [Mouse]
Matched Fields: category : Model System study : Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides
BALB/cJ is a commonly used inbred. Key traits include a susceptibility to developing the demyelinating disease upon infection with Theiler's murine encephalomyelitis virus. The BALB/cJ substrain is susceptible to Listeria, all species of Leishmania, and several species of Trypanosoma, but is resistant to experimental allergic orchitis (EAO).

NK

Model System  - [In Vitro] [Human]
Matched Fields: category : Model System study : Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides
Natural Killer cells. White blood cells;

TLR-MCV1 mouse

Model System  - [In Vivo] [Mouse]
Matched Fields: category : Model System study : Enhancing CRISPR Gene Editing in Somatic Tissues by Chemical Modification of Guides and Donors
TLR-MCV1 transgene knocked into Rosa26 locus

HEK-293T-disrupted_GFP-mcherry-Puro

Model System  - [In Vitro] [Human]
Matched Fields: category : Model System study : Enhancing CRISPR Gene Editing in Somatic Tissues by Chemical Modification of Guides and Donors
HEK293T cells with an integrated reporter for TLR1 reporter editing. HEK293T is an epithelial-like cell that was isolated from the kidney of a patient.

mTmG mouse

Model System  - [In Vivo] [Mouse]
Matched Fields: category : Model System study : Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides
ROSAmT/mG is a cell membrane-targeted, two-color fluorescent Cre-reporter allele. Prior to Cre recombination, cell membrane-localized tdTomato (mT) fluorescence expression is widespread in cells/tissues. Cre recombinase expressing cells (and future cell lineages derived from these cells) have cell membrane-localized EGFP (mG) fluorescence expression replacing the red fluorescence

HEK-293T with Ai9 transient reporter assay

Model System  - [In Vitro] [Human]
Matched Fields: category : Model System study : Develop Combinatorial Non-Viral and Viral CRISPR Delivery for Lung Diseases
HEK-293T cells transfected with an Ai9 inducible transgene reporter plasmid used to test gene editing activity by fluorescence. HEK293T is an epithelial-like cell that was isolated from the kidney of a patient.

Ai14 mouse

Model System  - [In Vivo] [Mouse]
Matched Fields: category : Model System study : Enabling Nanoplatforms for Targeted In Vivo Delivery of CRISPR/Cas9 Riboncleoproteins in the Brain
Ai14 mouse has a loxP-flanked STOP cassette preventing transcription of a CAG promoter-driven red fluorescent protein variant (tdTomato) - all inserted into the Gt(ROSA)26Sor locus. The att site flanked neo selection cassette has been removed in this strain.

HEK-293T-disrupted_GFP with MCV-mcherry-Puro

Model System  - [In Vitro] [Human]
Matched Fields: category : Model System study : Enhancing CRISPR Gene Editing in Somatic Tissues by Chemical Modification of Guides and Donors
HEK293T cells with an integrated reporter for TLR-MCV1 reporter editing. HEK293T is an epithelial-like cell that was isolated from the kidney of a patient.

Hepa1-6

Model System  - [In Vitro] [Mouse]
Matched Fields: category : Model System study : Enhancing CRISPR Gene Editing in Somatic Tissues by Chemical Modification of Guides and Donors
Stable mouse cell line of liver epithelial cells.

Neuro 2A

Model System  - [In Vitro] [Mouse]
Matched Fields: category : Model System study : Enhancing CRISPR Gene Editing in Somatic Tissues by Chemical Modification of Guides and Donors
Neuro-2a cells are mouse neuroblasts with neuronal and amoeboid stem cell morphology isolated from brain tissue.

Mouse Embryonic Fibroblasts

Model System  - [In Vitro] [Mouse]
Matched Fields: category : Model System study : Enhancing CRISPR Gene Editing in Somatic Tissues by Chemical Modification of Guides and Donors
Primary cell line

Ai9-SauSpyCas9 mouse

Model System  - [In Vivo] [Mouse]
Matched Fields: category : Model System description : Using CRISPR/Cas9 genome editing in mouse embryos, the existing Rosa-CAG-LSL-tdTomato-WPRE conditional
Using CRISPR/Cas9 genome editing in mouse embryos, the existing Rosa-CAG-LSL-tdTomato-WPRE conditional allele Gt(ROSA)26Sortm9(CAG-tdTomato)Hze (commonly referred to as Ai9) was modified to duplicate the guide target sequences for S. pyogenes and S. aureus Cas9 found on the 3' end of the loxP-flanked stop cassette [SpyCas9 5'GTATGCTATACGAAGTTAT (PAM AGG); SauCas9 5'ACGAAGTTATATTAAGGGTT(PAM CCGGAT)] onto the 5' end of the stop cassette. With this modification, a single guide RNA for S. pyogenes or S. aureus Cas9 can be used to mediate deletion of the stop cassette by non-homologous end joining and activation of tdTomato expression.

HEK-293-TgEF1a-eGFP-BSD

Model System  - [In Vitro] [Human]
Matched Fields: category : Model System study : Expanding CRISPR-Cas Editing Technology through Exploration of Novel Cas Proteins and DNA Repair Systems
HEK293 cells with lentiviral insertion of EF1a promoter driving expression of eGFP and SV40 promoter driving expression of BSD. HEK293 is an epithelial-like cell that was isolated from the kidney of a patient.

mTmG mouse (congenic)

Model System  - [In Vivo] [Mouse]
Matched Fields: category : Model System study : Enhancing CRISPR Gene Editing in Somatic Tissues by Chemical Modification of Guides and Donors
mTmG is a double-fluorescent reporter transgenic mouse which expresses membrane-targeted tdTomato flanked by loxP sequences, followed by membrane-targeted GFP. After genomic cleavage by Cas9 at two sites, or Cre recombinase between loxP sites, tdTomato expression is lost and GFP is expressed.
Show Experiments (7)

Ai9 mouse

Model System  - [In Vivo] [Mouse]
Matched Fields: category : Model System study : Develop Combinatorial Non-Viral and Viral CRISPR Delivery for Lung Diseases
Ai9 mouse has a loxP-flanked STOP cassette preventing transcription of a CAG promoter-driven red fluorescent protein variant (tdTomato) - all inserted into the Gt(ROSA)26Sor locus.
Show Experiments (11)

17 results for search term 'crispr'  in category Model System

Type Organism Subtype Name Description Source View Associated...
Organoid Human kidney organoid kidney organoid derived from human iPS cells Coriell Institute for Medical Research
Animal Mouse BALB/c mouse BALB/cJ is a commonly used inbred. Key traits include a susceptibility to developing the demyelinating disease upon infection with Theiler's murine encephalomyelitis virus. The BALB/cJ substrain is susceptible to Listeria, all species of Leishmania, and several species of Trypanosoma, but is resistant to experimental allergic orchitis (EAO). The Jackson Laboratory
Cell Human Primary cells NK Natural Killer cells. White blood cells; GreenCross LabCell
Animal Mouse TLR-MCV1 mouse TLR-MCV1 transgene knocked into Rosa26 locus
Cell Human Immortalized HEK-293T-disrupted_GFP-mcherry-Puro HEK293T cells with an integrated reporter for TLR1 reporter editing. HEK293T is an epithelial-like cell that was isolated from the kidney of a patient.
Animal Mouse mTmG mouse ROSAmT/mG is a cell membrane-targeted, two-color fluorescent Cre-reporter allele. Prior to Cre recombination, cell membrane-localized tdTomato (mT) fluorescence expression is widespread in cells/tissues. Cre recombinase expressing cells (and future cell lineages derived from these cells) have cell membrane-localized EGFP (mG) fluorescence expression replacing the red fluorescence The Jackson Laboratory
Cell Human Immortalized HEK-293T with Ai9 transient reporter assay HEK-293T cells transfected with an Ai9 inducible transgene reporter plasmid used to test gene editing activity by fluorescence. HEK293T is an epithelial-like cell that was isolated from the kidney of a patient.
Animal Mouse Ai14 mouse Ai14 mouse has a loxP-flanked STOP cassette preventing transcription of a CAG promoter-driven red fluorescent protein variant (tdTomato) - all inserted into the Gt(ROSA)26Sor locus. The att site flanked neo selection cassette has been removed in this strain. The Jackson Laboratory
Cell Human Immortalized HEK-293T-disrupted_GFP with MCV-mcherry-Puro HEK293T cells with an integrated reporter for TLR-MCV1 reporter editing. HEK293T is an epithelial-like cell that was isolated from the kidney of a patient.
Cell Mouse Hepatoma Hepa1-6 Stable mouse cell line of liver epithelial cells. ATCC
Cell Mouse Neuroblastoma Neuro 2A Neuro-2a cells are mouse neuroblasts with neuronal and amoeboid stem cell morphology isolated from brain tissue. ATCC
Cell Mouse Primary cells Mouse Embryonic Fibroblasts Primary cell line In-house: https://jacks-lab.mit.edu/protocols/making_mefs
Animal Mouse Ai9-SauSpyCas9 mouse Using CRISPR/Cas9 genome editing in mouse embryos, the existing Rosa-CAG-LSL-tdTomato-WPRE conditional allele Gt(ROSA)26Sortm9(CAG-tdTomato)Hze (commonly referred to as Ai9) was modified to duplicate the guide target sequences for S. pyogenes and S. aureus Cas9 found on the 3' end of the loxP-flanked stop cassette [SpyCas9 5'GTATGCTATACGAAGTTAT (PAM AGG); SauCas9 5'ACGAAGTTATATTAAGGGTT(PAM CCGGAT)] onto the 5' end of the stop cassette. With this modification, a single guide RNA for S. pyogenes or S. aureus Cas9 can be used to mediate deletion of the stop cassette by non-homologous end joining and activation of tdTomato expression. Baylor College of Medicine
Cell Human Immortalized HEK-293-TgEF1a-eGFP-BSD HEK293 cells with lentiviral insertion of EF1a promoter driving expression of eGFP and SV40 promoter driving expression of BSD. HEK293 is an epithelial-like cell that was isolated from the kidney of a patient.
Cell Human Primary cells Primary Airway Epithelia (Human) Primary airway epithelia from non-CF donors University of Iowa
Animal Mouse mTmG mouse (congenic) mTmG is a double-fluorescent reporter transgenic mouse which expresses membrane-targeted tdTomato flanked by loxP sequences, followed by membrane-targeted GFP. After genomic cleavage by Cas9 at two sites, or Cre recombinase between loxP sites, tdTomato expression is lost and GFP is expressed. The Jackson Laboratory
Show Experiments (7)
Animal Mouse Ai9 mouse Ai9 mouse has a loxP-flanked STOP cassette preventing transcription of a CAG promoter-driven red fluorescent protein variant (tdTomato) - all inserted into the Gt(ROSA)26Sor locus. The Jackson Laboratory
Show Experiments (11)